The short version of PPARδ agonist fits in a sentence. The long version — which is the one that helps — is below.
This page was last updated on 2026-06-06 and is reviewed periodically as new material appears.
PPARδ is a nuclear receptor that regulates gene expression related to fatty acid oxidation, glucose homeostasis, and mitochondrial function. GW501516 binds to this receptor with high affinity and activates downstream signaling in skeletal muscle and other tissues. Animal studies reported increased endurance and altered fuel preference, but human data remain limited and inconsistent. The precise relationship between receptor activation and observed physiological changes is still an area of active investigation. Researchers have also examined whether the compound affects inflammation or cell proliferation. No approved therapeutic indication exists for cardarine.
In laboratory settings, cardarine is studied as a tool compound for probing PPARδ biology. Published experiments often use cell cultures, rodent models, or isolated tissues. Some investigations focus on metabolic effects, while others assess potential risks such as carcinogenicity observed in long-term animal studies. Because human trials are sparse, most knowledge comes from preclinical work and adverse event reports. Scientific literature frequently notes the gap between animal findings and human outcomes. The compound is not a dietary supplement and is not intended for human consumption.
Cardarine is a common name for GW501516, a synthetic compound developed in the 1990s through research collaborations involving GlaxoSmithKline. It belongs to a class of molecules known as peroxisome proliferator-activated receptor delta agonists. Early studies explored its effects on lipid metabolism and energy expenditure in animal models. The compound was never approved as a human medicine, and clinical development was discontinued. In the years since, it has appeared in fitness and bodybuilding communities as a performance-enhancing substance. Regulatory agencies classify it as an unapproved drug.
Published literature on cardarine includes in vitro assays, rodent experiments, and a small number of human studies. Reports describe effects on exercise capacity and lipid metabolism in animals, while human evidence is sparse. Many online descriptions present the compound as a proven endurance aid, a claim not supported by regulatory approval or large clinical trials. Analytical studies focus on identifying the parent compound and its metabolites in biological samples. Important uncertainties include species differences, dose-response relationships, and the relevance of rodent tumor findings to humans.
Cardarine is the common name for GW501516, a synthetic compound studied as a peroxisome proliferator-activated receptor delta agonist. Researchers developed it to explore treatments for lipid disorders and metabolic conditions. It is not an approved medicine in any country. Early clinical work examined changes in HDL cholesterol and triglycerides, but development was discontinued after animal studies raised concerns about cancer. The compound remains available as a research chemical and appears in discussions of performance enhancement.
| Property | Value | Notes |
|---|---|---|
| CAS Registry Number | 317318-70-0 | Unique identifier for the compound. |
| Chemical class | PPARδ agonist | Synthetic ligand for peroxisome proliferator-activated receptor delta. |
| Appearance | White to off-white solid | Typical form of research-grade material. |
| Solubility | Soluble in DMSO and ethanol | Poorly soluble in water. |
| Typical storage | -20°C | Recommended for long-term storage of stock solutions. |
PPARδ is a nuclear receptor that influences transcription of genes involved in fatty acid oxidation, lipid transport, and energy homeostasis. GW501516 binds and activates this receptor with high selectivity relative to PPARα and PPARγ in laboratory assays. Activation alters expression of target genes in skeletal muscle, liver, and adipose tissue in animal models. The exact clinical consequences of these changes in humans remain incompletely characterized, and observed effects in animals do not establish therapeutic benefit or safety.
Published studies have examined GW501516 in animal models of obesity, insulin resistance, and exercise endurance. Early human trials reportedly ended, and development was discontinued after preclinical findings raised concerns about cancer in some rodent studies. Regulatory agencies have not approved cardarine for any medical use. Its availability through non-pharmaceutical channels raises questions about identity, purity, and legal status that are separate from its laboratory pharmacology. Those questions are often addressed through analytical testing rather than assumptions about product labels.
Clinical development stopped after rodent studies showed tumors at multiple sites. Whether those findings predict human cancer risk remains an open question, but they led sponsors to discontinue programs. Human safety data are limited to small, short-term studies that were not designed to assess cancer risk. Reported effects in those studies included changes in blood lipids, but the evidence is insufficient for medical use. Long-term consequences of nonmedical use are not well characterized. Questions about dose, duration, and individual susceptibility remain unresolved.
Cardarine is a common name for GW501516, an investigational compound developed in the 1990s for metabolic conditions. It acts as an agonist at peroxisome proliferator-activated receptor delta, a nuclear receptor involved in lipid and energy metabolism. The compound is frequently mislabeled as a selective androgen receptor modulator, or SARM, but its molecular target is different. GW501516 reached early clinical testing before development was discontinued. It has no approved therapeutic use in any country. The name cardarine is not a formal international nonproprietary name.
Since the analysis of spent nuclear fuel involves extremely harsh conditions, the application of disposable and rapidly produced devices (Based on castable and/or engravable materials such as PDMS, PMMA, and glass) is advantageous, although material integrity must be considered under specific harsh conditions. Through the usage of fiber optic coupling, the device can be isolated from instrumentation, preventing irradiative damage and minimizing the exposure of lab personnel to potentially harmful radiation, something not possible on the lab scale nor with the previous standard of analysis. The shrinkage of the device also allows for lower amounts of analyte to be used, decreasing the amount of waste generated and exposure to hazardous materials. Expansion of the PhLOC to miniaturize research of the full nuclear fuel cycle is currently being evaluated, with steps of the PUREX process successfully being demonstrated at the micro-scale. Likewise, the microfluidic technology developed for the analysis of spent nuclear fuel is predicted to expand horizontally to analysis of other actinide, lanthanides, and transition metals with little to no modification.
From a behavioral standpoint, one of the most valuable dinosaur fossils was discovered in the Gobi Desert in 1971. It included a Velociraptor attacking a Protoceratops, providing evidence that dinosaurs did indeed attack each other. Additional evidence for attacking live prey is the partially healed tail of an Edmontosaurus, a hadrosaurid dinosaur; the tail is damaged in such a way that shows the animal was bitten by a tyrannosaur but survived. Cannibalism amongst some species of dinosaurs was confirmed by tooth marks found in Madagascar in 2003, involving the theropod Majungasaurus. Comparisons between the scleral rings of dinosaurs and modern birds and reptiles have been used to infer daily activity patterns of dinosaurs. Although it has been suggested that most dinosaurs were active during the day, these comparisons have shown that small predatory dinosaurs such as dromaeosaurids, Juravenator, and Megapnosaurus were likely nocturnal. Large and medium-sized herbivorous and omnivorous dinosaurs such as ceratopsians, sauropodomorphs, hadrosaurids, ornithomimosaurs may have been cathemeral, active during short intervals throughout the day, although the small ornithischian Agilisaurus was inferred to be diurnal. Based on fossil evidence from dinosaurs such as Oryctodromeus, some ornithischian species seem to have led a partially fossorial (burrowing) lifestyle. Many modern birds are arboreal (tree climbing), and this was also true of many Mesozoic birds, especially the enantiornithines.
. If there is just a single detector, then the analyzer can sweep across the mass spectrum one slit at a time. With multiple detectors, the speed of analysis increases. A pure magnetic sector analyzer can achieve resolution ~10,000. With an added electrostatic focusing field before or after the magnetic sector, the analyzer can achieve resolution ~100,000. Particularly unstable ions may disintegrate while passing through the analyzer. If it undergoes the reaction Mz+ → M'z+ + (other parts) when entering the analyzer, it would undergo a circular motion of radius
Antoine Isaac Silvestre de Sacy, a fervently Catholic linguist and orientalist, delved into the Druze religion. His final and incomplete work, was the Exposé de la religion des Druzes (2 vols., 1838), focused on this subject. The Vatican Library houses several Druze manuscripts, primarily volumes of the Epistles of Wisdom or Rasa'il al-Hikmah, in copies backing to the 10th and 11th centuries.
=== On adult health maintenance === Once growth and development are completed, vitamins remain essential nutrients for the healthy maintenance of the cells, tissues, and organs that make up a multicellular organism; they also enable a multicellular life form to efficiently use chemical energy provided by food it eats, and to help process the proteins, carbohydrates, and fats required for cellular respiration.
Sources: en.wikipedia.org
Austin further cemented his heel turn the following Thursday on SmackDown!, when, during an interview with Jim Ross about his actions at WrestleMania, he thought Ross was denouncing their friendship and then assaulted Ross. Austin and Triple H became a team known as The Two-Man Power Trip. Austin altered his character considerably over the next few months by becoming a whiny, temperamental prima donna who complained incessantly when he felt he was not getting respect. He also developed a strange infatuation with McMahon, going to great lengths to impress him, even going so far as to hug him and bring him presents. Austin and Triple H ran roughshod over all their opponents, until coming up against The Undertaker and Kane. After defeating them for the WWF Tag Team Championship at Backlash on April 29, they held the tag team titles, the WWF Championship (Austin) and the Intercontinental Championship (Triple H) all at once. On the May 21 episode of Raw is War, Austin and Triple H defended the WWF Tag Team Championship against Chris Benoit and Chris Jericho; during the match, Triple H legitimately tore his quadriceps, and the team lost the match and the tag team championship. Austin officially broke up The Power Trip on that week's SmackDown!, criticizing Triple H for his injury and for hitting him with the sledgehammer. He continued to align himself with McMahon and began feuding with Jericho and Benoit by himself, leading to a triple-threat match at King of the Ring on June 24; despite interference from the debuting Booker T, Austin retained the championship.
There are approximately 300 types of garlic produced worldwide. Garlic market regions include North America, Europe and Asia-Pacific. Within China, which produces the largest amounts of garlic, there are five main provinces in which garlic is grown, including Shandong, Henan, Jiangsu, Yunnan and Hebei. As soft neck varieties tend to flourish in warmer climates where winters are mild, the Chinese provinces are suitable for harvesting and manufacturing garlic powder.
=== Metal sputtering === Sputtering of metals and metal oxide is one of the most established technique in cleanroom microfabrication. This approach has been adapted to sputter gold electrode onto paper-based microfluidic devices and demonstrated excellent performances DNA detection using quantum dots labels. One notable benefit of employing pure gold as the electrode material is the potential for leveraging self-assembled monolayer chemistry, which facilitates functionalization and anti-fouling of the electrode surface.
==== The Mariam Appeal ==== In 1998, Galloway founded the Mariam Appeal which was intended, according to its website's welcome page in 1999, "to campaign against sanctions on Iraq which are having disastrous effects on the ordinary people of Iraq". The campaign was named after Mariam Hamza, a child flown by the fund from Iraq to Britain to receive treatment for leukaemia. The intention was to raise awareness of the suffering and death of hundreds of thousands of other Iraqi children, due to poor health conditions and lack of suitable medicines and facilities, and to campaign for the lifting of the Iraq sanctions that many maintained were responsible for that situation. In 1999, Galloway was criticised for spending Christmas in Iraq with Tariq Aziz, who was Iraq's Deputy Prime Minister. In a 17 May 2005 hearing of the United States Senate Committee on Homeland Security and Governmental Affairs Permanent Subcommittee on Investigations, Galloway stated that he had many meetings with Aziz, and characterised their relationship as friendly. He said at another occasion that he and Aziz met more than ten times. During the 2003 invasion of Iraq, the fund received scrutiny after a complaint that Galloway used some donated money to pay for his travel expenses. He responded by stating that the expenses were incurred in his capacity as the appeal's chairman. Although the Mariam Appeal was never a registered charity and never intended to be such, it was investigated by the Charity Commission.
Sources: en.wikipedia.org
=== In pregnancy === For women who are pregnant and already have MG, in a third of cases, they have been known to experience an exacerbation of their symptoms, and in those cases, it usually occurs in the first trimester of pregnancy. Signs and symptoms in pregnant mothers tend to improve during the second and third trimesters. Complete remission can occur in some mothers. Immunosuppressive therapy should be maintained throughout pregnancy, as this reduces the chance of neonatal muscle weakness, and controls the mother's myasthenia. About 10–20% of infants with mothers affected by the condition are born with transient neonatal myasthenia gravis (TNMG), which generally produces feeding and respiratory difficulties that develop about 12 hours to several days after birth. A child with TNMG typically responds very well to acetylcholinesterase inhibitors, and the condition generally resolves over a period of three weeks, as the antibodies diminish, and generally does not result in any complications. However, a small percentage of fetuses and newborns with TNMG, particularly those who have antibodies directed against the fetal form of the AChR (their disorder is a subtype of TNMG termed the "acetylcholine receptor inactivation syndrome") have a more severe form of TNMG which includes weakness in skeletal muscles regulating breathing, respiratory failure, and various deformities such as arthrogryposis multiplex congenita. In some of these cases, the mother remains asymptomatic.
==== 700–799 ==== Register of County Court Judgments (Amendment) Regulations 1993 (S.I. 1993/710) County Court (Amendment) Rules 1993 (S.I. 1993/711) County Court (Forms)(Amendment) Rules 1993 (S.I. 1993/712) North Staffordshire Hospital Centre National Health Service Trust (Change of Name) Order 1993 (S.I. 1993/713) Housing Renovation etc. Grants (Prescribed Forms and Particulars) (Welsh Forms and Particulars) (Amendment) Regulations 1993 (S.I. 1993/715) Combined Probation Areas (Amendment) (No. 2) Order 1993 (S.I. 1993/716) A4 and A46 Trunk Roads (Batheaston/Swainswick Bypass and Slip Roads) Order 1993 (S.I. 1993/717) A4 and A46 Trunk Roads (Batheaston/Swainswick Bypass and Slip Roads) (Detrunking) Order 1993 (S.I. 1993/718) Export of Goods (Control) (Bosnia-Herzegovina) (ECSC) Order 1993 (S.I. 1993/719) Police (Common Police Services) (Scotland) Order 1993 (S.I. 1993/720) Grant for Bail Services (Scotland) Order 1993 (S.I. 1993/721) Social Security (Industrial Injuries) (Dependency) (Permitted Earnings Limits) Order 1993 (S.I. 1993/722) Social Security Benefits Up-rating Regulations 1993 (S.I. 1993/723) Income Tax (Sub-contractors in the Construction Industry) (Amendment) Regulations 1993 (S.I. 1993/724) Income Tax (Employments) (No. 24) Regulations 1993 (S.I. 1993/725) Income Tax (Employments) (No. 25) Regulations 1993 (S.I. 1993/726) Income Tax (Employments) (No. 26) Regulations 1993 (S.I. 1993/727) Rules of the Air (Second Amendment) Regulations 1993 (S.I. 1993/728) Derbyshire, Nottinghamshire and South Yorkshire (County and District Boundaries) Order 1993 (S.I.
== Society and culture == Melarsoprol is produced by Sanofi and under an agreement with the WHO, it donates melarsoprol to countries where the disease is common. Melarsoprol was used to treat a patient with second-stage African trypanosomiasis on season 1 episode 7 "Fidelity" of the medical drama House MD.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Octopuses generally avoid humans, but some conflictual incidents have been verified. For example, a 2.4-metre (8 ft) Pacific octopus, said to be nearly perfectly camouflaged, "lunged" at a diver and "wrangled" over his camera before it let go. Another diver recorded the encounter on video. All species are venomous, but only blue-ringed octopuses have venom that is lethal to humans. Blue-ringed octopuses rank amongst the most dangerous marine animals; their bites are reported each year across the animals' range from Australia to the eastern Indo-Pacific Ocean. They bite only when provoked or accidentally touched; bites are small and usually painless. The venom appears to be able to penetrate the skin without a puncture, given prolonged contact. It contains tetrodotoxin, which causes paralysis by blocking the transmission of nerve impulses to the muscles. This causes death by respiratory failure leading to cerebral anoxia. No antidote is known, but if breathing can be kept going artificially, patients recover within 24 hours. Bites have been recorded from captive octopuses of other species; they leave temporary swellings.
Sources: en.wikipedia.org
Cardarine is a common name for GW501516, a synthetic PPARδ agonist developed for research. It has not been approved as a medication in any country. It is classified as an unapproved drug and a prohibited substance in sport.
No. Cardarine is not an anabolic steroid; it belongs to a different chemical class that targets PPARδ. Steroids act primarily through androgen receptors, while cardarine acts through a nuclear receptor involved in metabolism.
Some rodent studies reported increased endurance and changes in fat metabolism after cardarine exposure. Long-term studies in animals also raised concerns about cancer in certain tissues. Human trial data are limited, so these findings cannot be directly translated to people.
Cardarine is a common name for the investigational compound GW501516. It acts as a PPARδ agonist and is not approved for human use. It is prohibited in sport.